Review



mmlv reverse transcriptase reaction cocktail  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Promega mmlv reverse transcriptase reaction cocktail
    Mmlv Reverse Transcriptase Reaction Cocktail, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mmlv+reverse+transcriptase+reaction+cocktail/mmlv+reverse+transcriptase+reaction+cocktail/10__1677_slash_erc___07___0041-53-10-15
    Average 90 stars, based on 1 article reviews
    mmlv reverse transcriptase reaction cocktail - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Reverse Transcription:

    Article Title: Expression of GnRH type II is regulated by the androgen receptor in prostate cancer
    Article Snippet: Quantitative mRNA expression was evaluated through real-time PCR using a 7900-HT sequence detection system (Applied Biosystems, Foster City, CA, USA). .. Total RNA extracted from cell lines was first treated with MMLV Reverse Transcriptase reaction cocktail (Promega) according to manufacturer’s instructions. .. QPCR was performed by Jumpstart SYBR Green mastermix (Sigma) and primers designed using primer express 2.0 (Applied Biosystems) as follows: GnRH II forward 50 CAGAACTTC GGCTTCCGTTT 3 0 and reverse 5 0 CTGCTCACAGGTCTTTCGCTTG 30, GAPDH forward 50 CGACCACTTTGTCAAGCTCA 30 and reverse 50 GGGTCTTACTCCTTG GAGGC 3 0, PSA forward 50 GGTGCATTACCGGAAGTGGAT 30 and reverse 50 TGGTCATTTCCAAGGTTCCAAG 30, F1R1 forward 50 GCTTTC TATGTTCTAATGAGAGGGATA 30 and reverse 50 TCCTGAAAAATCTAAACCAGA GCC 30, F2R2 forward 50 TAAACAGGCCTCTGACCCCC 30 and reverse 50 TACCTA CCCCGGAGTGGCT 30 and ARE I forward 50 CCTAGATGAAGTCTCCATGAGCTACA 30 and reverse 50 GGGAGGGAGAGCTAGCACTTG 30.



    Similar Products

    90
    Promega mmlv reverse transcriptase reaction cocktail
    Mmlv Reverse Transcriptase Reaction Cocktail, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mmlv+reverse+transcriptase+reaction+cocktail/mmlv+reverse+transcriptase+reaction+cocktail/10__1677_slash_erc___07___0041-53-10-15
    Average 90 stars, based on 1 article reviews
    mmlv reverse transcriptase reaction cocktail - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results